Низкая цена
Всего 249a за скачивание одной диссертации
Скидки
75 диссертаций за 4900a по акции. Подробнее
О проекте

Электронная библиотека диссертаций — нашли диссертацию, посмотрели оглавление или любые страницы за 3 рубля за страницу, пополнили баланс и скачали диссертацию.

Я впервые на сайте

Отзывы о нас

Генетическая характеристика штаммов вируса болезни Ньюкасла, выделенных на территории России и сопредельных государств : диссертация ... кандидата биологических наук : 03.00.03, 03.00.06

Год: 2005

Номер работы: 71509

Автор:

Стоимость работы: 249 e

Без учета скидки. Вы получаете файл формата pdf

Оглавление и несколько страниц
Бесплатно

Вы получаете первые страницы диссертации в формате txt

Читать онлайн
постранично
Платно

Просмотр 1 страницы = 3 руб



Оглавление диссертации:

Вирус болезни Ньюкасла (ВБН) или APMV-1 (Avian Paramyxovirus

1) нринадлежит нодсемейству к семейству парамиксовирусов роду Avulavirus {Paramyxoviridae), [70,71]. Семейство Paramyxovirinae, парамиксовирусов включает ряд вирусов, вызываюш;их опасные заболевания человека и животных, среди них особенно печально известны такие вирусы, как вирус кори {measles), респираторно синцитиальный вирус (RSV), вирус нарагриппа (parainfluenza), вирус инфекционного паротита (mumps), вирус болезни Ньюка

В соответствии с классификацией, принятой Международным Комитетом Систематики Вирусов 2000-м году, семейство Paramyxoviridae было разделено на два иодсемейства: Paramyxovirinae и Pneumovirinae. Paramyxovirinae включает роды, Respirovirus, Rubulavirus, Morbillivirus, а также ряд неклассифицированных вирусов NiV (Nipah virus), ПеУ (Hendra virus) и TPMV (Tupaia Pneumovirus и У/ГМ-У). Подсемейство Pneumovirinae объединяет роды Вирус болезни Пьюкасла (ВБН) Metapneumovirus. принадлежит роду R

Молекулярно-биологическая характеристика вируса болезни Ньюкасла

1.2.1. Структура вириоиа Все представители семейства Paramyxoviridae имеют двухслойную липидную оболочку, которая образуется из нлазматической мембраны нри выходе вируса из клетки хозяина. Встроенные в оболочку гликопротеиновые "шипы" выступают над её поверхностью примерно на 8-12 нм и хорошо различимы с помоп]|;ью электронного микроскопа. Они представляют собой поверхностные гликопротеины, F (белок слияния) и B S (гемагглютининDT нейраминидазу белок прикрепления), которые обеспечи

Геномная однонитевая (-)РНК вируса БН составляет норядка 15 тысяч (^ н.о. в длину и имеет на концах нетранслируемые области, тогда как у представителей вирусов в пределах семейства длина геномной РНК варьирует от 15 тысяч н.о. до 19 тысяч н.о. З'-нетранслируемый участок или лидер состоит, примерно, из 50 нуклеотидов. 5'-нетранслируемый участок длиной 50-161 н.о. называется (-)лидер или трейлер. Эти регуляторные участки, имеющие значение для транскрипции и трансляции, примыкают к шести послед

2.1. NP - нуклеокапсидный белок Данные по структуре и функциям белков вирусов семейства Paramyxoviridae в основном базируются на результатах исследований вируса Сендай. Нуклеокапсидный белок (NP) выполняет несколько функций в репликации вируса, включая инкапсидацию геномной РНК в РЬЖ-аза устойчивый нуклеокапсид (являющийся матрицей для всех вирусных РНК синтезов), ассоциацию с белками Р и L, необходимую для создания рибонуклеопротеинового комплекса во время транскрипции и репликации в

Характерной чертой парамиксовирусов является способность нарабатывать несколько белковых продуктов с одного гена Р (С, С , D, I, Р, V, W, X, Y1, Y2 и Z), который в свою очередь является примером максимальной компактности кодирования генетической информации в небольшом гене. Такая способность связана с использованием перекрывающихся открытых рамок считывания (ORF) единственного мРНК транскрипта. Этот процесс транскрипции известеп как Р1Ж редактирование или псевдоматричное добавление нукл

2.2.а. Фосфопротеин (Р) Фосфопротеин (Р-протеин) является единственным продуктом гена Р, который необходим для вирусного синтеза РБК и включён во все его аспекты. Этот белок входит в состав вирусного рибонуклеопротеина (РНП) и образующегося в инфицированной клетке полимеразного комплекса. Несмотря на то, что L белок содержит все каталитические активности, свойственные вирусному РЕП, он присоединяется к комплексу ЫР:РРЖ посредством домена L (411-445 а.о.) С-концевого участка белка Р. Извест

Белки V и W вируса БН транслируются с собственных мРЬЖ, образующихся в результате мРНК редактирования с добавлением одного или двух внематричных G остатков в сайте редактирования гена Р, соответственно (рис. 5). Сайт редактирования мРНК гена Р (UUUUUCCC; + цепь) консервативен среди представителей рода Avulavirus. Анализ мРНК продуктов гена Р показал, что на долю Р-кодирующих мРНК приходится 68%, а V и W мРНК - 29% и 2%, соответственно [74]. Белки Р, V и W имеют сходный N-конец и различные

У представителей парамиксовирусов матриксный М белок является одним из наиболее консервативных вирусных белков, кроме того он количественно нреобладает в структуре вириона, нежели другие белки. Его аминокислотная последовательность варьирует от 341 до 375 а.о. (38,5 - 42,5 кДа). Белок М является вполне основным (заряд при нейтральном рН - от +14 до +17) и отчасти гидрофобным, хотя и не имеет доменов достаточной длины, чтобы крепиться в двух слоях липидной мембраны. Различные исследования по

Протеин слияния (F) парамиксовирусов опосредует проникновение вируса в хозяйскую клетку слиянием вирусной оболочечной и клеточной плазматической липидных мембран при нейтральном значении рН. Результатом слияния является доставка нуклеокапсида в цитоплазму клетки. Позднее, при инфекции F белок экспрессируется и локализуется на цитоплазматической мембране клетки, при этом он способен вызывать слияние с соседними клетками с образованием синцития. Эта способность белка обуславливает цитопатичес

Поверхностный белок гемагглютинин-нейраминидаза (HN) вируса БН является его главной антигенной детерминантой и выполняет несколько функций. Он отвечает за адсорбцию вируса к клеточным рецепторам, содержащим сиаловую кислоту, которыми могут быть гликопротеины или гликолипиды [7]. Этим его свойством так объясняется способность агглютинировать эритроциты, называемая гемагглютинирующая отщепление активность. Кроме того, он опосредует ферментативное сиаловой кислоты с поверхности вириона и

Ген L является наиболее нротяжённым среди других генов вируса БН (порядка 6,7x10^ и.о.) и кодирует вирусную РНК-зависимую РВК полимеразу. В пользу того, что L белок является вирусной РНК-зависимой РНК полимеразой, говорят факты о его низком количественном содержании в вирионе (порядка 50 копий на вирион), его большом размере (более 2x10^ а.о.) и расположении в транскрипционно-активном вирусном коре. К настоящему моменту определена нуклеотидная последовательность гена L и предсказан аминокисл

Процесс расщепления F-белка необходим для слияния вирусной ^ оболочки с клеточной мембраной и, соответственно, для репликации вируса, что было показано на клеточных культурах. Установлено, что эффективность расщепления F-протеина нанрямую определяет вирулентность ВБН in vivo и способность вируса лизировать культуры клеток ш vitro [16, 36]. ЦI Образующаяся в ходе трансляции гена F молекула Fo (предшественник белка слияния) является биологически неактивной. В результате протеолитического нарез

1.2.4. Адсорбция и проникновение вируса в клетку Одной из важных стадий в жизненном цикле вируса БН является его прикрепление к клеточной цитоплазматической мембране и проникновение нуклеокапсида в цитоплазму. Узнавание вирионом клеточного рецептора и его прикрепление к цитонлазматической мембране осуществляется за счёт активности гемагглютинин-нейраминидазы. Рецепторами для белка HN могут являться содержащие сиаловую кислоту гликопротеины и гликолипиды (сиалогликолипиды или ганглиозиды). С

Как известно к настоящему моменту, все стадии репликации генома вируса БН и других представителей семейства Paramyxoviridae происходят в цитоплазме хозяйской клетки (рис. 11). Синтез мРНК парамиксовирусов нечувствителен актиномицин к D нренаратам [26], кроме интеркалирующим того ДНК, таким как способны парамиксовирусы реплицироваться в безъядерных клетках [86]. В культуре клеток жизненный цикл нарамиксовирусов протекает в пределах от 14 до 30 часов, однако он может проходить за более коротк

Все синтезы вирусных РНК вируса БН начинаются с 3 '-конца геномной или антигеномной РНК. Последовательности цис-действующего промотора выполняют две функции, инициируя синтез лидерной и трейлерной ("-" лидерной) РНК. Синтез лидерной РНК необходим для синтеза вирусным нуклеонротеином первой мРНК гена NP. В условиях дефицита свободного белка NP происходит терминация транскрипции лидерной РНК и её реинициация в начале гена NP (напротив второго нуклеотида десятого гексамера). Реинициаци

Исторически изоляты ВБН разделяют на три категории по характеру патогенности (лентогенные, мезогенные и велогенные), основываясь на тестах патогенности in vivo [12, 13, 14]. Одним из основных качеств. ^^'^1.;';VU::ET^^ характеризующих различные штаммы ВБН, является их натогенность для цыплят и куриных эмбрионов. В настоящее время Международное эпизоотическое бюро (МЭБ) требует характеристику изолятов ВБН по вирулентности на цыплятах и/или по аминокислотному составу сайта протеолитической

Быстрота детекции и установления характера патогенности штаммов ВБН является важнейшей необходимостью болезни Ньюкасла в домашних и для локализации вспышек птицеводческих промышленных хозяйствах. С этой целью в мировой практике применяются различные методы [8]. Ранее для детекции и изоляции штаммов ВБН иснользовался метод биопробы на куриных эмбрионах с последуюш;ей характеристикой в реакциях торможения гемагглютинации (РТГА) с применением вирусспецифичных поликлональных сывороток и реакци

Глава 2. СОБСТВЕННЫЕ ИССЛЕДОВАНИЯ МАТЕРИАЛЫ И МЕТОДЫ

2.1. Анализируемые штаммы из базы даииых GenBank Для проведения филогенетического анализа и генотипирования исследуемых штаммов и положительных образцов полевого материала были использованы штаммы из базы данных GenBank (табл. 3). Генотиповая принадлежность штаммов, представленных в таблице 3, выделенных на различных географических территориях и за широкий временной промежуток, была установлена с помош;ью генотипируюп];ей системы, предложенной Aldous с соавторами в 2003 г. [9]. Нуклеотидные

2.2. Исследуемые штаммы В качестве исследуемого материала были использованы штаммы ВБН, выделенные на территории России и Казахстана, а также четыре штамма из коллекции вирусов института вирусологии им. Д.И. Ивановского, собранных на территории Украины и Белоруссии (табл. 4). Из нолевого материала, собранного в дельте Волги (Астраханская область) в эпидсезоне 2001 г., было изолировано 27 штаммов ВБН [5]. Однако для секвенирования нуклеотидных носледовательностей и установления изолированные

2004 г. В 2004 г. 142 клоакальных смыва от диких птиц (водного, околоводного и наземного экологических комплексов) и 40 от домашних птиц были собраны на юге Приморского края (на территории Приханкайской низменности и на побережье залива Посьета) в период осенних миграций. Исследуемые образцы полевого материала были собраны от диких птиц шести отрядов, семи семейств, девяти родов - обидим счётом восемнадцати видов, а также от домашних уток и гусей. Образцы полевого материала (клоакальные

2.4. Олигонуклеотиды использованные в экснернментах В работе были использованы синтетические олигонуклеотиды производства фирмы "Литех". Структуры праймеров и их назначение приведены в таблице 5. Таблица 5. Первичная структура олигонуклеотидов, использованных в работе. № Последовательность олигонуклеотидного Название праймера CACCCAACGTGCTGTCGCAGTGAC 1005F ACAATCTTGCGCTCAATGTCACTATT 614F TAACTTGACTATGATTGACCCTGTCTG TTTGTGGCCCGAATACTGTAGTCA CGCAGTGACCGCTGACCACGAG ATCAGAATGCT

К 200 мкл суспензии исследуемого образца (аллаитоисная жидкость или клоакальные смывы) добавляли 200 мкл лизирующего раствора (4 М гуанидин изотиоцианат, 0,5% саркозил, 100 мМ (З-меркаптоэтанол, 25 мМ цитрат натрия), перемешивали на вортексе. Добавляли 200 мкл насыщенного водой фенола, 100 мкл хлороформа и 40 мкл ацетата натрия (2 М, рН=4,5), вортексировали и инкубировали 20 мин. при 4°С. Центрифугировали при 13000g 20 мин. Отбирали водную фазу и добавляли к ней равный объем изопропанола (400

Реакцию обратной транскрипции для синтеза кДНК небольшой длины проводили в

0.5 мл пробирках для ПЦР, объём реакционной смеси составлял 5 мкл. В пробирку вносили 2,65 мкл РНК и денатурировали её при 70°С в течение 1,5 мин на водяной бане и сразу же переносили в лед. В пробирку с денатурированной РНК добавляли 2,35 мкл "мастерской" смеси следующего состава: (приведены конечные концентрации реагентов) 50мМ Трис-НС1, рН=

8.3, 3 мМ MgCb, 75 мМ КС1, 10 мМ DTT, по

0.5 мМ

2.7. Проведение нолимеразной ценной реакции Нолученная кДБК использовалась в полимеразной цепной реакции (ПЦР) для амплификации фрагментов генома вируса БН. Нолимеразную ценную реакцию нроводили как в тонкостенных нробирках объемом 0,2 мл (Costar), так и в среднестенных объемом 0,5 мл (QSP) на амнлификаторах Mastercycler gradient (Eppendorf, Германия) и Терцик (ДНК-технология, Россия). В зависимости от концентрации вируссодержащего материала НЦР нроводили в одностадийном штаммов) и или "

В настоящей работе 5'-концевая последовательность геномной РНК определена только для штамма Sterna/Astrakhan/2755/2001. На рисунке 12 представлена стратегия амплификации 5'-концевого участка генома. Начальным этапом был синтез кД1Ж с олигонуклеотидного праймера 14222F и обработка РНК-азой для удаления геномной РНК. Следующим этапом было удлинение нолученной кДНК с 3'-конца за счёт присоединения терминальной трансферазой dC остатков. Общий объем реакционной смеси составлял 10 мкл. В

Электрофорез препаратов ДНК проводили в 1-2 % агарозном геле, с использованием агарозы фирмы Pharmacia, в 1х трис-ацетатном буфере (ТАЕ) следующего состава: 40 мМ трис-ацетат рН=

8.0, 2 мМ ЭДТА в течение 30 минут при 100 В. Перед нанесением пробы на гель к ней добавляли 0,1 объем буфера для нанесения, содержащего 50% глицерина и 0,1% бромфенолового синего. Для визуализации ДНК гель прокрашивали в течение 10-20 минут в растворе бромистого этидия (5 мкг/мл в ТАЕ). Учет результатов провод

. Перед реакцией секвенирования амплифицированные фрагменты ДНК проходили очистку в агарозном геле. Зону геля соответствующую разбегу нужного фрагмента вырубали и растворяли в 1 мл раствора Nal (

6.6 М Nal, 16 мМ Na2SO3). После растворения агарозы добавляли 10 мкл glass milk. Сорбцию ДНК проводили в течение 30 мин. при 16° С. Следующим этапом выделения ПЦР-фрагмента являлось промывание сорбционных частиц 80% этанолом. ДНК элюировали с подсушенного осадка glass milk добавлением 25-30 м

Первичную нуклеотидную последовательность определяли по методу Сэнгера при помощи BigDye прямого Termination секвенирования Cycle ГЩР-продукта Kit с использованием инструкции Sequencing ДНК согласно на изготовителя. Электрофорез осуществлялся автоматическом секвенаторе ABI Prism® 3100 DNA sequencer (Applied Biosystem, США).

. Для построения алайментов использовали алгоритмы Clustal V и Clustal W из пакета программ DNASTAR V.

3.12, производства «Lasergen Inc.» (Madison, WI). Построение филогенетических деревьев осуществляли на основе двух алгоритмов: "ближайшего соседа" или "UPGMA" в рамках 2параметрической модели М. Кимуры с последующим 1000-кратным ресэмплингом (MEGA

2.1). Вычисление коэффициента корреляции данных филогенетического анализа (значений дивергенции) проводили с помощ

Глава 3. РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЙ И ИХ ОБСУЖДЕНИЕ

3.1. Создание лабораторного варианта ОТ-НЦР тест-системы для детекции РНК вируса БН в биологических образцах Одной из задач данной работы было создание детекционной ОТ-ПЦР тест-системы РБК вируса БН, совмещённой с определением генотиновой принадлежности ПЦР-положительных образцов на основе сиквенса амплифицируемых фрагментов ДНК. Для создания такой тест-системы необходимо было выбрать адекватные участки генома для дизайна олигонуклеотидных праймеров. С этой целью нами было проведено сравн

3.2. Генетическая характеристика штаммов ВБН, выделеиных иа территории России и соиредельных государств Одной из задач в данной работе было применение созданной лабораторной ОТ-ПЦР тест-системы для изучения штаммов ВБН, выделенных на территории России и сопредельных государств. "Российские" штаммы, которые были исследованы в данной работе, представлены в виде трёх групп (всего 15 штаммов). Первая группа состояла из штаммов, выделенных на территории Украины (Chicken/Kiev/l 033/83, Б

3.2.1. Исследоваиие штаммов ВБН, изолированиых на территории России, Украины и Белоруссии Вирусы изолированные в Астраханской области Из штаммов, выделенных из полевого материала в дельте Волги (Астраханская область) в эпидсезоне 2001 г., в работу было взято четыре штамма ВБН (табл.

4) как от наиболее представительных хозяев: Coot/Astrakhan/2743/2001 от лысухи (F. atra), добытой в средней дельте Волги (Икрянинский район Астраханской области); Cormorant/Astrakhan/2751/2001 от большого

3.2.2. Анализ штаммов ВБН, изолированных от сельскохозяйственных нтиц в Казахстане в 1988-2004 гг. Штаммы ВБН (всего

44) изолированные на птицеводческих хозяйствах трёх областей КазахстанаАлматинской, Талдыкорганской и Жамбылской были выделены от домашней птицы за период с 1988 по 2004 гг. (табл. 4). Для этих штаммов была определена нуклеотидная последовательность протяжённостью 1083 и.о., охватываюп];ая участок гена М (100 а.о., С-конец белка М), расстояние между кодирующими последо