Низкая цена
Всего 249a за скачивание одной диссертации
Скидки
75 диссертаций за 4900a по акции. Подробнее
О проекте

Электронная библиотека диссертаций — нашли диссертацию, посмотрели оглавление или любые страницы за 3 рубля за страницу, пополнили баланс и скачали диссертацию.

Я впервые на сайте

Отзывы о нас

Изучение функций различных доменов нового транскрипционного коактиватора SAYP (E(y)3) Drosophila melanogaster и поиск взаимодействующих с ним белков : диссертация ... кандидата биологических наук : 03.00.03

Год: 2005

Номер работы: 71490

Автор:

Стоимость работы: 249 e

Без учета скидки. Вы получаете файл формата pdf

Оглавление и несколько страниц
Бесплатно

Вы получаете первые страницы диссертации в формате txt

Читать онлайн
постранично
Платно

Просмотр 1 страницы = 3 руб



Оглавление диссертации:

1.1 РНК-полимераза II Транскрипция является первым этапом реализации наследственной информации клетки. Процесс транскрипции можно разделить на четыре основные стадии: связывание белков транскрипционного аппарата с ДНК и поиск промотора, инициация, элонгация и терминация. ДНК-зависимые РНК-полимеразы осуществляют синтез РНК на матрице ДНК и являются ключевыми компонентами не способны транскрипционного самостоятельно аппарата. Эукариотические РНК-полимеразы инициировать транскрипцию. Для э

Гены класса II содержат регуляторную область, с которой связываются белки транскрипционного аппарата, и кодирующую область, содержащую информацию о структуре кодируемого данным геном белка. Регуляторная область гена включает промотор, проксимальные и дистальные элементы. Эти последовательности необходимы для правильной инициации и регуляции транскрипции (Патрушев, 2000). Основным элементом регуляторной области гена класса II является промотор. Промотор представляет собой участок ДНК от - 40 д

Как уже было отмечено, РоШ не способна сама узнавать промоторы и инициировать транскрипцию. Для этого необходимы общие факторы транскрипции (GTFs, General transcription factors) (Orphanides et al., 1996; Roeder, 1996). Это так называемые TFII (Transcription Factors of RNA polymerase II), среди которых вьщеляют TFIIB, E и F - как необходимые для экспрессии всех генов, и TFIIA, Н и D (ТВР и TAFs) - как вариабельные компоненты (Veenstra & Wolffe, 2001). TFIIA не является типичным GTF, т. к

Специфические факторы транскрипции способны влиять на уровень экспрессии того или иного гена, связываясь с регуляторными последовательностями ДНК. Последние содержат сайты связывания определенного набора специфических транскрипционных факторов, что позволяет гену своевременно реагировать на множество разнообразных событий в клетке. Одни специфические регуляторы влияют на транскрипцию на уровне инициации (Q-богатые), другие - в основном на уровне элонгации транскрипции, третьи — на обоих уровн

Таким образом, ключевым моментом инициации транскрипции РоШ является сборка сложного мультибелкового комплекса в районе промотора. Для того, чтобы эта 18 сборка успешно осуществилась, в промоторной области не должно быгь посторонних белков. Это условие не всегда выполняется, так как ДНК находится в клетке в комплексе с множеством белков, формируя структуру, называемую хроматином. Разные районы хроматина отличаются разной степенью компактизации, ковалентными модификациями ДНК и гистонов. В со

Гетерохроматин представляет собой необычайно компактное образование, в составе которого ДНК практически недоступна для воздействий извне. Это было неоднократно продемонстрировано в экспериментах по обработке хроматина нуклеазами и ферментами, способными ковалентно модифицировать ДНК (например, ДНКметилтрансферазами). Высокий уровень компактизации ДНК в гетерохроматине достигается посредством взаимодействия нуклеосом друг с другом и с мультибелковыми комплексами негистоновых белков. Среди мод

Основным модельным объектом в исследованиях гетерохроматина является D. melanogaster. Гетерохроматин составляет 30% генома этого насекомого. Одна из особенностей гетерохроматина — способность репрессировать транскрипцию эухроматиновых генов, перемещённых в гетерохроматиновую область. Изменение активности гена при изменении его положения в геноме называется эффектом положения гена. Особый случай представляет эффект положения мозаичного типа (МЭП, английская аббревиатура - PEV, position effect

Классическая передача сигнала извне в клетку — это сложный многостадийный процесс, который начинается с взаимодействия лиганда с рецептором. мембранно-связанным Затем рецептор инициирует в цитоплазме клетки каскад событий, результатом которого становится влияние специфических факторов транскрипции на экспрессию генов в ядре. Транскрипционные факторы, относящиеся к суперсемейству ядерньпс рецепторов, благодаря своему уникальному строению, используют другую стратегию. Ядерные рецепторы в сост

И у позвоночных, и у насекомых половое созревание инициируется увеличением титра гормонов и опосредуется членами суперсемейства ядерных рецепторов. У позвоночных основную роль в этом процессе играют тиреоидные и половые гормоны, в то время как у насекомых созревание регулируется экдистероидами. Экдистероиды - стероидные гормоны насекомых, сходные по строению с экдизоном - играют центральную роль в жизненном цикле, контролируя прохождения всех стадий постэмбрионального развития. Некоторые уник

1.1 Штаммы и вектора S. cerevisiae и Е. coli, использованные в работе Для двухгибридного скрининга использовался штамм дрожжей L40 с генотипом МАТа HIS3A200 trpl-901 leu2-3, 112 ade2 LYS2::(lexAop)4-HIS3 URA3::(lexAop)8-lacZ GAL4. Для двухгибридного скрининга были использованы вектора:

- рАСТ2 (Clontech) - вектор, кодирующий AD транскрипционного фактора GAL4. Содержит ген LEU2, позволяющий дрожжам расти на среде без лейцина. В вектор рАСТ2 клонирована библиотека кДНК из эмбрионов Д mela

. Для двухгибридного скрининга использовалась библиотека кДНК из эмбрионов D. melanogaster, клонированная в вектор рАСТ2 по сайтам рестриктаз EcoRl-Xhol, любезно предоставленная А. Солдатовым. Представительность библиотеки не менее 10* клонов.

. Для культивирования дрожжей использовались среды: YPD (бакто-пептон (2%), бакто-дрожжевой экстракт (1%), бакто-агар (1,8%) (для чашек), глюкоза (2%)) и SD (Difco yeast nitrogen base without amino acids (0,67%), бакто-агар (2%) (для чашек), глюкоза (2%), аденин (0,02%), урацил (0,02%), изолейцин (0,03%), валин (0,15%), аргинин (0,02%), гистидин (0,02%), лейцин (0,1%), лизин (0,03%), метионин (0,02%), фенилаланин (0,05%), треонин (0,2%), триптофан (0,02%), тирозин (0,03%)). Для культивировани

. В работе использовались ферменты фирм Fermentas, Gibco, Promega с соответствующими буферами, реактивы фирм Serva, Sigma, Roche.

. В работе были использованы следующие праймеры:

1) для секвенирования конструкций в векторе pBTMl 17с: Btms_for (5' CCATTGAAGGGCTGGCGGTTGG 3'), Btms_rev (5' CGCCCGGAATTAGCTTGGCTGC 3');

2) для секвенирования клонов библиотеки кДНК в векторе рАСТ2: ADF (5' CTATTCGATGATGAAGATACCCCACCAAACCC 3'), ADR (5' GTGAACTTGCGGGGTTTTTCAGTATCTACGAT 3');

3) для ПЦР клонов библиотеки кДНК в векторе рАСТ2: 334 (5' CAGTATCTACGATTCATAGATCTCTCGAG 3'), 335 (5' GGGGATCCGAATTCGCGG 3');

4) для

LexA-SAYP (1273-1629) - фрагмент кДНК SAYP, кодирующий а.о. 1273-1629, субклонирован в вектор pBTMl 17с по сайтам рестриктаз Ncol-Xhol. LexA-SAYP (1273-1629) - фрагмент кДНК SAYP, кодирующий а.о. 1273-1629, субклонирован в вектор pBTMl 17с по сайтам рестриктаз Ncol-Smal. LexA-SAYP (1366-1629) - содержит фрагмент кДНК SAYP, кодирующий а.о. 1366-1629. Получена из конструкции LexA-SAYP (1273-1629) путем обработки рестриктазой SafL и ДНК-полимеразой фага Т4 для достройки «липких» концов и последу

LexA-SAYP(l-362) - фрагмент кДНК SAYP, кодирующий а.о. 1-362, субклонирован в вектор pBTMl 17с по сайтам рестриктаз Sati-Sacl. LexA-SAYP(361-644) - фрагмент кДНК SAYP, кодирующий а.о. 361-644, субклонирован в вектор pBTMl 17с по сайтам рестриктаз NheI-Ncol(T4). LexA-SAYP(643-889) - фрагмент кДНК SAYP, кодирующий а.о. 643-889, субклонирован в вектор рВТМ 117с по сайтам рестриктаз Sali-Sacl. LexA-SAYP(888-1273) - фрагмент кДНК SAYP, кодирующий а.о. 888-1273, субклонирован в вектор pBTMl 17с по

1.9 Конструкции для анализа функций доменов белка SAYP in vivo. Конструкция Р{е(у)3} была предоставлена Ю. Шидловским. Содержит геномный фрагмент, фланкированный сайтами рестриктазы ВатШ. в положениях 1800 п.н. «выше» начала первого экзона и 1400 п.н. «ниже» стоп кодона гена е(у)3, в векторе pCaSpeRS. Кодирует полноразмерный белок SAYP (а.о. 1-2008). Конструкция Р{е(у)3^''"^} была получена из конструкции Р{е(у)3+} посредством обработки рестриктазой Stul и последующего «самолигирования».

.

2.1.1 Трансформация дрозкзкей индивидуальной плазмидой

А) Приготовление компетентых клеток. Дрожжи рассевали на чашку со средой YPD-arap и растили 2-3 суток при 30°С до появления колоний 2-3 мм в диаметре. Несколько колоний пересевали в жидкую среду YPD (50

мл) и растили в течение ночи при 30°С с покачиванием (250 об/мин). Пересевали дрожжи в 300 мл YPD до ОВбоо=0,3, растили 3 ч, осаждали дрожжи центрифугированием (4500 об/мин, 5 мин), супернатант удаляли и ресуспендировал

2.2.1 Приготовление компетентных клеток. Бактерии рассевали штрихом на чашку с селективной средой, растили в течение ночи при 37°С, несколько колоний помещали в 40 мл среды SOB (2% Bactotriptone; 0,55% Bacto Yeast extract; 5M NaCl; IM KCl; O.OIV 2M Mg^"'{= IM MgCb+lM MgS04}) и растили на 37°C с покачиванием (200-ЗООоб/мин). В 50 мл пробирку помещали 30 мл культуры; охлаждали в ледяной бане 10 мин и осаждали центрифугированием (4500 об/мин, 10 мин, 4°С). Удаляли супернатант и ресус

2.3.1 Экспрессия и очистка рекомбинантного белка. Для экспрессии рекомбинантного белка Нг46 соответствующей конструкцией трансформировали клетки Е. соИ XL2-Blue. Выросшими колониями инокулировали среду 2YT (50 мг/мл ампициллина) и растили клетки с покачиванием при температуре 30°С до оптической плотности ОВбоо=

0.6 . Затем индуцировали экспрессию белка добавлением в среду IPTG до концентрации 0,1-1 мМ. Экспрессию проводили в течение Зч. Клетки осаждали центрифугированием (4500 об

Разведение мух проводили по стандартным методикам. Мутации е(у)3'''vi. е(у)3^'^^' поддерживались в линиях y'w'e(y)3"'/FM4, ^w"e(y)3"'/FM4. )/"'e(y)3"'/FM4 и y^W^e(y)3^"^'/FM4.

2.4.1 Проверка влияния мутации е(у)3"' на экспрессию трансгенов, встроенных в гетерохроматиновые районы. Самок у'w'e(y)3'''/FM4 скрещивали с самцами X/ Y; P[hsp26-pt, hsp70-w] /P[hsp26pt. hsp70-w] из линий, несущих вставку трансгена P[hsp26-pt, hsp70-w] в различные районы гетеро