Низкая цена
Всего 249a за скачивание одной диссертации
Скидки
75 диссертаций за 4900a по акции. Подробнее
О проекте

Электронная библиотека диссертаций — нашли диссертацию, посмотрели оглавление или любые страницы за 3 рубля за страницу, пополнили баланс и скачали диссертацию.

Я впервые на сайте

Отзывы о нас

Разработка и апробация тест-систем на основе гелевых биочипов для изучения генетического полиморфизма человека : диссертация ... кандидата биологических наук : 03.00.15, 03.00.03

Год: 2005

Номер работы: 71482

Автор:

Стоимость работы: 249 e

Без учета скидки. Вы получаете файл формата pdf

Оглавление и несколько страниц
Бесплатно

Вы получаете первые страницы диссертации в формате txt

Читать онлайн
постранично
Платно

Просмотр 1 страницы = 3 руб



Оглавление диссертации:

1.3 Особенности нроведения мультиплексной ПЦР и гибридизации...

1.4 Конструирование биочина. Блочный подход

3.1.

1.5 Блочная организация микрочипа

3.1.

1.6 Анализ контрольных и диагностических образцов. Специфичность и чувствительность метода

3.1.

1.7 Алгоритм создания биочипов для анализа генетического полиморфизма

3.2 Создание "кардиочипа"

3.2.1 Выбор генов и нолиморфных вариантов

3.2.2. Схема и структура микрочипа

3.2.3 Анализ контрольных и диагностических образцов

3.3 Сравнение метода гибридизации па биочипах с классическими методами анализа генетического полиморфизма

3.4 Применение биочипов в медицине и биологии

3.5. Анализ полнморфизма генов ренин-ангиотензиновой и кннинбрадикининовой систем у больных артериальной гинертензией и в контроле

3.5.1 Сравнительный анализ частот аллелей и генот

. Лавинообразное нарастание интереса к изучению генетической предрасноложенности требует разработки новых подходов к идентификации и анализу ДНКполиморфизма. Современное развитие науки невозможно без создания новых технологий, позволяющих-проводить анализ множества генетических изменений одновременно. Одним из наиболее перспективных методов для решения этой задачи является метод мультиплексной ПЦР с дальнейшей гибридизацией на олигонуклеотидной матрице (Kolchinsky and Mirzabekov, 2001; Nasedk

.

1.1 Микрочипы в диагностике и научных исследованиях.

1.1.1 Нанотехнологии на основе бнологнческих микрочипов. Интенсивное развитие технологий гибридизации и амплификации нуклеиновых кислот на рубеже 70-х - 80-х годов нрошлого века ознаменовало новую эноху в молекулярной биологии и нозволило раскрыть природу многих наследственных и мультифакториальных заболеваний, нроанализировать структуру значительного числа генов человека и модельных объектов. В настоящее время эти нодходы нолучили широкое распространение не только в исследовательской работе,

1.1.2 Перспективные методы анализа генетического иолиморфизма. С помощью биочинов можно анализировать различные варианты изменений в молекуле ДНК: начиная от трансклокаций, дупликаций, протяженных делеций и заканчивая микродуплнкациями и микроделециями, а также однонуклеотиднымн заменами (Kolchinsky and Mirzabekov, 2001; Nasedkina et al, 2002, 2003; Favis et al, 2000; Landi et al, 2003; Колчинский и др., 2005; Wang et al, 2005). Технологии разработки и изготовления ДНК-чинов различаются разме

1.1.3 Биочипы для изучения геиетической предрасиоложеииости. Развитие технологии биочипов привело к созданию не только исследовательских, но и к развитию диагностических вариантов тест-систем. Причем в последнее время большинство фирм и научно-исследовательских групп стали переходить от так называемых биочипов "высокой плотпости" ("high density") (Landi et al, 2003, "Affymetrix") к биочипам "низкой нлотности" ("low density") (Wen et al, 2003;

1.2 Изучение генетического нолиморфизма реннн- ангиотензиновой н кннни-браднкининовой енетемы.

1.2.1 Генетический полиморфизм и сердечио-сосудистая система.

1.2,

. Генетический полиморфизм определяется как наличие двух и более альтернативных вариантов гена, встречающихся в популяции с частотой не менее 5%. Первоначально понятие "генетического полиморфизма" применялось в большей степени для характеристики фенотипических особенностей организма. И только после массового внедрения новых методов молекулярной биологии (особенно ПЦР) и начала программы "ГЕНОМ ЧЕЛОВЕКА" это понятие стали относить непосредственно к молекуле ДНК. Генетически

. Болезни сердца и сосудов - главные причипы заболеваемости, инвалидизации и преждевременной смертности в России. По данным эпидемиологов в России ежегодно от сердечно-сосудистых заболеваний умирает более 1,2 млн. человек (Александров, 1997). Наиболее распространенный диагноз - ишемическая болезнь сердца (ИБС) и артериальная гипертензия (АГ). Среди причин сердечно-сосудистых заболеваний можно выделить как «внешние» факторы, так и «внутренние». К «внешним» факторам риска можно отнести курение,

1.3 Гены «нредрасноложенности» к сердечно-сосудистым заболеваниям. На данный момент известно более полутора сотеп гепов, полиморфные варианты которых связывают с предрасположенностью к сердечно-сосудистым заболеваниям (Нефедова и Шварц, 1998; Шляхто и Конради, 2002; Пузырев, 2003; Cheng et al, 1999; Liljedahl et al, 2003; Zateishchikov et al, 2004). Стоит отметить, что одними из первых в мире подобные исследования были проведены в начале 90-х годов нрошлого века в Санкт-Петербурге под руковод

2 Артериальная гипертензия.

. Артериальная гипертензия (АГ) относится к мультифакториальным заболениям сердечно-сосудистой системы. Клинической характеристикой артериальной гинертензии является стойкое повышение артериального давления: систолического >140 мм.рт.ст. и/или диастолического >90 мм.рт.ст., зарегистрированных не менее чем при двух врачебных осмотрах, при каждом из которых артериальное давлепие (АД) измеряется, по крайней мере, дважды (Ратова и др., 2001; Образцова и др., 2005). Артериальная гипертепзия

. Сведения о влиянии наследственного фактора при развитии артериальной гипертензии стали накапливать достаточно давно. Однако нервая обобщенная информация о наследовании АГ в семьях появились к 20-30-м годам XX века (Пузырев, 2003). На основе этих данных было установлено следующее: нричипой АГ является как средовые, так и наследственные факторы. Причем характер наследования далеко не всегда можно было объяснить менделеевскими закономерностями. Таким образом, было установлено, что АГ является

. Белковые продукты генов ренин-ангиотензиновой системы являются одними из самых важных регуляторов кровяного давления и гомеостатичеекой функции ночки, обеспечивая ноддержание жизненно необходимых процессов в организме. Анатомической основой данной системы является юкстагломерулярный аннарат почки, клетки которого выделяют в кровь фермент ренин (Lifton et ah, 2001; Naber et al, 2004a,b). Ренин (продукт гена REN), воздействуя на ангиотензиноген (продукт гена AGT), превращает его в ангиотензин

.

4.1 Ренин. Ген ренин (REN) локализован на длинном плече 1-ой хромосомы в локусе Iq32. Он содержит 9 экзонов, и его размер составляет 12 т.п.о. Ген ренин экспрессирует транскрипт около 1,5 т.п.о. Молекулярный вес белкового продукта гена ренина составляет 45 кДа. Его первичная структура состоит из 406 а.к. с преи просегментами, содержащими 20 и 46 а.к, соответственно. Главным образом ренин экспрессируется клетками ночек - нефронами. Он катализирует первый щаг в активации ренин- ангиотензиновог

. Ген ангиотензиноген^ (^G7) также как и ген ренина локализован на длинном плече 1-ой хромосомы, но в локусе Iq42-q43. Он содержит 5 экзонов, и его размер составляет 12 т.п.о. Ген ангиотензиноген экснрессирует транскрипт около 1 т.п.о^Молекулярный вес его белкового продукта составляет 53 кДа. Его первичная структура соД р руур СТОИТ из 452 а.к. ("GeneCards"; "NCBI"; Procopciuc et al., 2002). Ангиотензиноген экспрессируется главным образом в печени, под контролем эстрогенов

1.2 АЗ Ангиотензинпревращающий фермент. Ген ангиотензинпревращающего фермента (АСЕ) локализован на длинном плече 17-ой хромосомы в локусе 17q23. Он содержит 26 экзонов, и его размер составляет 45 т.п.о. Ген ангиотензинпревращающего фермепта эспрессирует мажорный транскрипт размером около 5 т.п.о. Молекулярный вес белкового продукта гена составляет 150 кДа. Его первичная структура состоит из 1306 а.к. ("GeneCards"; "NCBI"; Hubert et al, 1991; Tanaka et al, 2003). Ангиотензи

1.2 A A Рецептор 1 к ангиотензину II, Ген рецептора 1 к ангиотензину II (AGTR1) локализован на длинном плече 3-й хромосомы в локусе 3q21-q25. Он содержит 5 экзонов, и его размер составляет 55 т.п.о. Первые четыре экзона кодируют 5'-некодирующую носледовательность. Кодирующая последовательность в 2 т.п.о. ограничена 5-м экзоном. Молекулярный вес белкового нродукта гена рецептора 1 к ангиотензину II составляет 41 кДа. Его первичная структура состоит из 359 а.к. ("GeneCards"; "NCB

4.5 Рецептор 2 к ангиотензину П. Ген рецептора 2 к ангиотензину II {AGTR2) локализован на длинном плече X хромосомы в локусе Xq22-q23. Он содержит 3 экзона размером в 3,8 т.п.о. Кодирует мРНК рецептора только третий экзон. AGTR2 экспрессирует транскрипт около 1 т.п.о. Молекулярпый вес белкового продукта гена составляет 41 кДа. Его первичная структура состоит из 363 а.к. ("GeneCards"; "NCBI"; Herrmann et al, 2002; Jin et al, 2003). Рецептор 2 к ангиотензииу II экспрессирует

. Ген рецептора 2 к брадикинину (BKR2') расположен на длипном плече 14-й хромосомы в локусе 14q

32.1-q

32.2. On содержит 3 экзона, и его размер составляет 39,5 т.п.о. BKR2 экспрессирует транскрипт около 1,2 т.п.о. Молекулярный вес белкового продукта гена BKR2 составляет 55 кДа. Его первичная структура состоит из 391 а.к. Брадикининовый рецептор экспрессируется в различных органах и тканях, в том числе и в эндотелии. Он участвует в вазорелаксации сосудов, стимулируя выработку эндот

5 Комнлексное изучение ассоциации нолиморфизма генов ренинангиотензиновой системы с нредрасположепностью к артериальной гинертензии. В настоящее время известно, что в большинстве случаев мультифакториальная природа артериальной гипертензии обусловлена генетическим полиморфизмом ренинангиотензиновой и кинин-брадикининовой систем. Эти заключения основываются на многочисленных исследованиях проведенных при изучении ассоциации АГ с поли- морфными вариантами генов этих систем (Naber et al, 2004a,

.

2.1 Характеристика исследуемых груии. Было обследовано 179 детей в возрасте от 9 до 17 лет с артериальной гипертензией (АГ). АГ, как диашоз для направления на комплексное обследование в консультативно-диагностический центр, ставился в тех случаях, когда при казуальных измерениях артериального давления (АД) у ребенка неоднократно (не менее 3-х раз при отдельных визитах к врачу) отмечался его повышенный уровень. Уровень АД считался повышенным, если ноказатель систолического АД или диастолическо

2.2 Синтез олигонуклеотидов и изготовление микрочинов. Олигопуклеотиды для иммобилизации на микрочине синтезировали на автоматическом синтезаторе 394 DNA/RNA Synthesizer ("Applied Biosystems", США) с иснользованием стандартной фосфоамидитной процедуры. На 3'-конце олигонуклеотидов находился снейсер со свободной аминогруппой, который вводили при синтезе с помощыо З'-Amino-Modifier С7 CPG 500 ("Glen Research", США). Последовательность олигонуклеотидов, используемых для иммоб

2.3 Экстракция геномной ДНК из лимфоцитов нериферической крови и клеток буккального энителия. А) Выделение ДНК из лимфоцитов периферической крови. Выделение ядер проводили в соответствии с методикой приведенной в руководстве Сэмбрука (Sambrook et al, 1989), с некоторыми модификациями. 1. К 2 мл крови добавляли 100 мкл ЭДТА. 1^ "^ •'"'""-'''''"'"'' • " •'' '' ' "^ '" '^^' ,^\ ,." 2. Смешивали кровь (обычно на пробу брали 500-1000 мкл) с равным

2.4 Проведение полимеразной цепной реакцнн. Нуклеотидные последовательности искомых фрагментов генов получали из интернет-базы "Nucleotide" ("NCBI", США). Праймеры, необходимые для амплификации этих фрагментов, подбирали с использовапием программы "Oligo 6" (США). Специфичность праймеров проверяли в программе "Nucleotide-nucleotide BLAST" ("NCBI", США). ,.

2.4.1 Амплификация фрагмеитов ДНК для аиализа методом ПААГ. Методом полимеразной ценной реакции иселедовали нолиморфизм двух генов: АСЕ и BKR2. Типы изученных полиморфных аллелей, ноеледовательности олигопраймеров приведены в таблице 5. Таблица 5. Нуклеотидные последовательности праймеров для ПЦР с последующим аиализом методом ПААГ. ПРАИМЕР ГЕН нолиморфизм АСЕ название ACF1 ACRI BKR2 последовательноеть 5'-3' CTGGAGACCACTCCCATCCTTTCT, ATGTGGCCATCACATTCGTCAGAT ACTCCAGCTCTGGCTTCTGGG GAAGGAAGGG

2.4.2 Амнлификация фрагментов ДНК для анализа методом гибридизации на олигонуклеотидном биочине. А) Гены системы биотрансформации и метаболизма лекарств {типы изу- ченных мутаций (полиморфизма) и последовательности олигопраймеров приведены в табл. 6). Таблица 6. Нуклеотидные последовательности праймеров для мультиплексных ПЦР с последующим анализом методом гибридизации иа "фармакогенетическом биочипе". ПРАИМЕР ГЕН полиморфизм Раунд 1 CYP1A1 4887ОА + 4889A>G 6235'1>С CYlAlFlex

. Продукты амплификации (фрагментов генов АСЕ и BKR2) разделяли в 6% геле, приготовленном на 1х трис-боратном буфере (ТБЕ) в аппарате для вертикального электрофореза, с длиной стекла 15-20см. Исходные растворы для приготовления 30% ПААГ на 100 мл водного раствора: 29 г акриламида (Sigma ,USA), 1г Н,М-метил - бисакриламида ("Sigma", США); 10х ТБЕ на 500 мл водного раствора: 54 г Tris ("Serva, Германия"),

27.5г борной кислоты ("Serva", Германия), 20 мл

2.6 Визуализация ПЦР продуктов в агарозпом геле. Наличие ПЦР нродуктов, необходимых для гибридизации на олигонуклеотидном биочнпе анализировали в 2 % геле, нриготовленном на 1х трис-ацетатном буфере (ТАЕ) в аннарате для горизонтального электрофореза. Исходные растворы для нриготовления 2% агарозного геля на 100 мл водного раствора: 2 г агарозы (DNA Grade, "Bio Rad", США), 2 мл 50хТАЕ; 50хТАЕ на 100 мл водного раствора:

24.2 г Tris ("Serva", Германия),

5.7 мл ле

2.7 Гибридизация мечеиого продукта па микрочипе. Гибридизацию на микрочинах нроводили с иснользованием флуоресцентно меченых образцов, полученных на второй стадии мультинлексной ПЦР, в 32 мкл смеси следующего состава: 8 мкл формамида ("Serva", Германия), 8 мкл 20х SSPE ("Promega", США) и 16 мкл амплификата (по 4 мкл образца из каждой мультиплексной реакции в случае анализа генов биотрансформации и по 8 мкл - в случае анализа генов сердечно-сосудистой системы). Гибридизацио

2.8 Регистрация изображеиия и его обработка. Флуоресцентный сигнал от ячеек микрочипа регистрировали с помощью широкопольного люминесцентного микроскопа, снабженного камерой ПЗС и программным обеспечением Imageware ("Биочип-ИМБ", Россия) (рис. 7). 8Ш Krsui №« Next group(s) is not detected: GSTTI.GSTMI List detection: CYP1Air2A) CYP2D6, G1934A(G/G) CYP2D6, DelA2637(+/+) NAT2(S1/N) CYP2C19, G681A(G/G) CYP2C9, A1075C(A/A) CYP2C9, С430С(СЯ) MTHFR, C677T(C/T) Рис. 7. Интерфейс прог

2.8.1 Анализ "фармакогенетического биочина". 1. При анализе интенсивности флуоресценции использовали среднее значение между двумя дублирующими ячейками. Сигналы Jm сортировали по возрастанию и строили гистограмму (рис. 8). 4,5-| 4- s°- 3 1 I

2.5 w^ 0 ^- 0 1 5 - I fjfttl|l iH»*** ~t ^ ^ g-e- 1 0,5 n 1 4 7 1013 1619 22 2528 3134 37 40 43 46 49 52 55 58 Номер ячейки Рис. 8. Значения нормированных сигналов флуоресценции с ячеек "фармакогенетического биочипа". Яче

. 1. при анализе интенсивности флуоресценции отбрасывали два крайних значения сигналов с дважды продублированных ячеек (самое большое и самое маленькое), а оставшиеся два усредняли. Сигналы Jm сортировали по возрастанию и строили гистограмму (рис. 9). 2,5 и/

1.5 II

§й 1 5 9 13 17 21 25 29 33 37 41 45 49 53 57 61 номер ячейки Рис. 9. Значения нормированных сигналов флуоресценции с ячеек "сердечно-сосудистого биочипа". Ячейки 1-28 имеют значения флуоресценции, сравнимы

2.9 Статистическая обработка даниых. При сравнении результатов использовали точный критерий Фишера (Животовский, 1991), пакеты программ "GraphPad InStat" (США) и STATISTICA

5.5 (США).

.

3.1 Разработка алгоритма создания биочип-тест-систем для анализа генетического нолиморфизма человека.

3.1.1 Создание "фармакогенетического биочипа".

3.1.

1.1 Выбор генов и полиморфных вариантов. На основе анализа многочисленных данных зарубежной и отечественной литературы для онределения индивидуальной чувствительности к фармацевтическим нрепаратам и изучения генетической нредрасиоложенности к некоторым мультифакториальньш заболеваниям, в том числе и онкологическим, наибольший интерес представляют аллельные варианты следующих генов: CYP1A1 (4887С>А, 4889A>G и 6235

4).

3.2.2. Схема и структура микрочипа. Схема "кардиочипа" показана на рис. 19. Олигонуклеотидные зонды обозначены ячейками, каждой из которых соответствует определенная аллель или гаплотип конкретного гена. Олигонуклеотидные пробы в составе биочипа также сгруппированы в блоки. Блок №1 предназначен для выявления полиморфизма по генам REN (I9-83G>A), AGT (М235Т), AGTR1 (1166А>С), AGTR2 (3123С>А). Выявление этих однокуклеотидных замен позволяет выявлять как мутантные ал