Низкая цена
Всего 249a за скачивание одной диссертации
Скидки
75 диссертаций за 4900a по акции. Подробнее
О проекте

Электронная библиотека диссертаций — нашли диссертацию, посмотрели оглавление или любые страницы за 3 рубля за страницу, пополнили баланс и скачали диссертацию.

Я впервые на сайте

Отзывы о нас

Регуляция экспрессии генов коровой части острова патогенности бактерий рода Yersinia транскрипционным регулятором YbtA : диссертация ... кандидата биологических наук : 03.00.03

Год: 2005

Номер работы: 71481

Автор:

Стоимость работы: 249 e

Без учета скидки. Вы получаете файл формата pdf

Оглавление и несколько страниц
Бесплатно

Вы получаете первые страницы диссертации в формате txt

Читать онлайн
постранично
Платно

Просмотр 1 страницы = 3 руб



Оглавление диссертации:

3.1. Бактериальные среды

3.2. Антибиотики 4. Работа с бактериями

4.1. Условия роста

4.2. Трансформация клеток

4.3. Хранение культур 5. Использованные стандартные молекулярно-биологическис и биохимические методы

5.1. Полнмеразная Цепная Реакция (ПЦР)

5.2. Выделение и очистка ДНК

5.2.1. Выделение хромосомальной ДНК

5.2.2. Выделение плазмид

5.2.3. Выделение ПЦР-фрагментов

5.3. Выделение РНК и реакция удлинения праймера

5.3.1. Выде

Для всех патогенных бактерий эффективное обеспечение железом является основной предпосылкой для развития и распространения в тканях хозяина. Железо это необходимый фактор роста почти для всех бактерий (за исключением Lactobacteriaceae, Borrelia burgdorferi), так как оно необходимо в многочисленных окислительно-восстановительных процессах, как, например, при транспорте кислорода, электронном транспорте по дыхательной цепи и синтезе нуклеиновых кислот. Железо - это четвертый по распространённо

1.2 Сидсрофоры

1.2.1 Характеристика сидерофоров Бактерии разработали различные стратегии для извлечения железа из окружающей среды, которое находится либо в нерастворимых комплексах, либо связано с транспортными или депонирующими белками. Одна из них - продукция сидерофоров, низкомолекулярных соединений массой от 100 до 500 дальтон, обладающих высоким сродством к железу (Braun, Hantke, and Koster, 1998; Earhart, 1996). Их функция состоит в обеспечении клетки железом, которое является регулятором их биосинте

. Значительная часть работ по изучению сидерофоров имела отношение к энтеробактериям, в особенности Е. coli и S. tiphimutium, а так же к энтеробактериям родов Yersinia и Pseudomonas. Относительная легкость получения мутантов сильно способствовала исследованиям в этой области. Эти бактерии обладают клеточной стенкой, состоящей из внешней и внутренней мембран и пептидогликанового слоя (Costerton et al, 1974). Последний действует как молекулярное сито и обеспечивает бактериям механическую прочно

2.2 Род Yersinia Ранее известный как Pasteurella, данный род получил в 1964 своё сегодняшнее название Yersinia по фамилии первооткрывателя возбудителя чумы А. Иерсина. Род Yersinia является членом семейства Enterobacteriaceae (Frederiksen, 1964). В настоящее время известны 11 различных видов. 3 из них имеют медицинское значение (Brenner, 1979): Y. pestis является возбудителем чумы, а Y. enterocolitica и Y. Pseudotuberculosis распространённые энтеропатогены (Кпарр, 1988). Их температурный опти

2.3 Системы утилизации железа в Y. enterocolitica Y. enterocolitica может использовать как собственный (эндогенный) сидерофор, так и экзогенные сидерофоры, произведенные другими организмами. (Табл. 1). Кроме того, йерсинии могут утилизировать гемин (Stojiljkovic et al., 1992; Stojiljkovic et al., 1994a). Захват осуществляется, как и в случае других грамм - отрицательных бактерий, ТопВ - зависимыми специфическими рецепторами на внешней мембране. Так же недавно описана ТопВ сидерофор - независи

Образующиеся при недостатке железа сидерофоры выделяются в окружающую среду. Секреция осуществляется при помощи транспортных белков - переносчиков, таких как EntS, необходимый для экспорта энтеробактина (Furrer et al., 2002). Для бактерий рода Yersinia, однако, такой переносчик до сих пор не идентифицирован (Perry et al., 2004). Сидерофоры связывают внеклеточное железо и затем комплекс захватывается специфическими ТопВ - зависимыми рецепторами внешней мембраны. Дальнейший транспорт к цитоплаз

. Бактерии синтезируют цитоплазматические железосвязывающие белки. Так, геном Y. pestis содержит гены бактериоферритина {bfrA), ассоциированного с бактериоферритином ферридоксина {bfd) и ферритина А {ftnA) (Parkhill et al., 2001; Deng et al., 2002). Однако в настоящее время точно не известно, выполняют ли эти белки функцию храпения железа. Обнаруженные цитоплазматические железосодержащие высокомолекулярные комплексы, агрегаты 19-килодальтонного белка, могут состоять как из BfrA, так и из FtnA

. В грамотрицательных бактериях регулятор экспрессии Fur репрессирует экспрессию многих генов, включая и системы утилизации железа. В условиях избытка железа, комплекс Fur и Fe ^ связывается со специфическим сайтом связывания (FBS, Fur binding site) в регулируемых промоторах и ограничивает их транскрипцию (Escolar et al., 1999; Hantke, 1981). При дефиците железа свободный Fur не является репрессором (Hantke, 2001). Мутации в гене fur ведут к неспособности бактерий расти в условиях избытка же

2.7. Исрсиниабактин. Синтез сидерофора в патогенных йерсиниях постулировался уже в 1975 (Wake et al, 1975). С помощью индикаторного агара (CAS-Agar) позднее было показано, что только высокопатогенные штаммы Y. enterocolitica производят сидерофор йерсиниабактин (Yersiniabaklin, Ybt) (Heesemann et al, 1987). В 1995 йерсиниабактин был очищен из культуры Y. enterocolitica и была определена его структурная формула, напоминающая структуру пиохелина (Pyochelin) из Pseudomonas aeruginosa (Drechsel Н,

2.8. Остров патогеиности (High Pathogenicity Island, HPI). Первоначально было обнаружено, что синтезирующиеся в железодефицитных условиях белки HMWP1 и HMWP2 (High Molecular Weight Proteins; 240 kDa и 190 kDa соответственно), a также белок внешней мембраны 1ф65 (Iron-Repressible Protein, 65 kDa) находятся только в высокопатогенных, вирулентных для мышей йерсиниях. Также было выяснено, что эти белки критичны для вирулентности (Camiel et al, 1987; Camiel et al, 1992; Heesemann et al, 1993). Дал

. В настоящее время известно множество регуляторных белков, группируемых на основании гомологии последовательности в несколько семейств: AraC/XilS (Gallegos et al, 1993), ArsR (Morby et al, 1993), AsnC (Куф1ае8 et al, 1995), Сф (Spiro et al, 1990), DeoR (Beck et al., 1992), GntR (Buck et al., 1989), IclR(Reverchon et al., 1991), LacI(Weickert et al., 1992), LuxR/UphA (Henikoff e/ al, 1990) LysR (Henikoff e/ al., 1988), MarR (Dehoux et al, 1995), MerR (Hclmann et al., 1990a; Helmann et al, 199

.

. Согласно данным сиквенса, YbtA состоит из 319 аминокислот, его изоэлектрическая точка -

9.65, молекулярная масса -

35.8 т.п.о. Нуклеотидная последовательность vt}\a.ybtA и его трансляция представлены ниже: DNA: atgacggagtcaccgcaaacgcaatccgaaatctctattaaccagttggtggtcgggaaa + lfr: . M - ' T - - E " S " P " Q " T - ' Q " S " E " I " S " I " N " Q " L ' - V " V " G - ' K DNA: cctgcaaacgatggcaatattcctgctcagtgtgaa

3.2.2. YbtA-регулируемые промоторы. Выравнивание последовательностей контролируемых YbtA промоторов выявило консенсусную последовательность, представленную двумя высокогомологичными повторами RS1 и RS2 (Fetherston et al, 1995; Rakin et al, 1994), возможно являющуюся сайтом связывания YbtA (рис.5). Для дивергентных промоторов уЫА и irp6 предполагаемые регуляторные сайты RS1 и RS2, так же как и сайт связывания Fur (FBS, Fur Binding Site), по-видимому, являются общими. fyuA Fy»^ ^ RS2 FBS

. Таблица 2: Используемое оборудование. Устройство Аналитические весы Термостат Камера для SDS-электрофореза Аппарат для электропорации Модель R160P ТурВ20 Mini-Protean®-II Cell Gene-Pulser II, Pulse Controller II Цитометр Френчпресс ПЦРАмплификатор рН-метр Фотометр Пипетки Сиквенатор Источник питания Трансилюминатор Лазерный сканер Центрифуги Coulter epics XL-MCL French pressure cell 40K PCR System 2400 PE 320 pH Meter Ultrospec 3000 Research PIO-PIOOO ABI 377 DNA Sequencer PE Power Рас 3000

. Таблица 4: Праймеры, использованные в работе. Праймер 8307_FAM 9585_FAM FyuAFFAM 8621 9782 FyuAR 8307 RSlFp RSlRp RS2Fp RS2Rp RS3Fp RS3Rp 8307Hind 8621BamH 8307YpsHind 8621YpsBam 8307BamH 8621 Hind 8307YpsBamH 8621YpsHind 9585Hind 9782BamH GFPpr_ext_FAM YbtA_NdeI YbtA BamHI Последовательность (5' - 3') FAM -TTGAGATAACATGGGAGTAA FAM - CCTAAATTCCTCCCTGACAG FAM - GACCGTTATCGCCATTCTG TGACTCCGTCATGACTTGGT AGAAATCATTTTTCCTCCTG CCGTGTCATTTTCATTGTTG TTGAGATAACATGGGAGTAA Pho - TTTATACCCTAAATAGTTCGAG