На сайте проводятся работы. Работоспособность будет восстановлена к 12:00 3 июля

Низкая цена
Всего 249a за скачивание одной диссертации
Скидки
75 диссертаций за 4900a по акции. Подробнее
О проекте

Электронная библиотека диссертаций — нашли диссертацию, посмотрели оглавление или любые страницы за 3 рубля за страницу, пополнили баланс и скачали диссертацию.

Я впервые на сайте

Отзывы о нас

Структура и анализ генома вируса Карши : диссертация ... кандидата биологических наук : 03.00.03

Год: 2006

Номер работы: 71645

Автор:

Стоимость работы: 249 e

Без учета скидки. Вы получаете файл формата pdf

Оглавление и несколько страниц
Бесплатно

Вы получаете первые страницы диссертации в формате txt

Читать онлайн
постранично
Платно

Просмотр 1 страницы = 3 руб



Оглавление диссертации:

Около ста лет назад Вальтер Рид описал патогенный для человека вирус жёлтой лихорадки, ставший типовым представителем рода Flavivirus семейства Flaviviridae. С тех пор были идентифицированы более 80 представителей этого рода, большинство из которых переносят комары или клещи. Представители этой группы вызывают опасные заболевания для человека и животных. Вирус Денге {Denge virus), вирус Западного Нила (WNV), вирус японского (JEV) и клещевого энцефалитов (TBEV) являются возбудителями тяжёлых з

В июле 1972 г. из клещей вида Ornithodoros papillipes, обнаруженных в норах большой песчанки в окрестностях Каршинской степи Узбекистана (20 км на юго-восток от Бешкента), впервые были выделены и идентифицированы три штамма вируса Карши: LEIV-2247 Uz, LEIV-2251 Uz, LEIV-2252 Uz [73]. Через год в пустынной зоне Балхашского района Алмаатинской области на юге Казахстана из клещей Hyalomma asiaticum, снятых с верблюда, был изолирован ещё один штамм, обозначенный как Каз-816 кл [Каримов, 1978]. В

При подкожном заражении белых мышей вирус проявляет себя как слабопатогенный (2,07 lg ЛД50/мл) и как среднепатогенный при внутримозговой инъекции (5,97 lg ЛД50/мл). Оптимальное накопление вирусоснецифического антигена наблюдалось в клеточной линии СПЭВ через 24-48 часов. При этом максимальное накопление вируса Карши в культуральной среде СПЭВ наблюдалось через 40 часов носле заражения. В первично-трипсинизированной культуре клеток куриного эмбриона под агаром вирус образует четкие бляшки с р

1.2.1. Патогенные свойства вируса Вирус Карши является нантропным с наиболее выраженным поражением центральной нервной системы млекопитаюндих животных. Распространяется вирус в организме животных гематогенным путём. Наиболее чувствительными животными являются белые мыши. Инфекция у них протекает с более четко выраженным поражением ЦНС. При внутрицеребральном заражении белых мышей заболевание начинается на 3-й день и заканчивается на 4-5 день летальным исходом. В инфицированном орга

Вирус Карши является слабопатогенным для человека, но способен вызывать острое лихорадочное заболевание с сыпью под названием лихорадка Карши. Описаны случаи заболевания лихорадкой Карши людей в Казахстане. Больным, инфицированным вирусом Карши через укус клеш;а, был поставлен диагноз острое респираторное заболевание. Последуюш,ие исследования иммунологических свойств антигена позволили идентифицировать вирус Карши как возбудителя [5]. По данным казахских исследователей в сыворотке 2,1% нас

Карши Па основании серологических реакций (реакции нейтрализации, реакции связывания комплемента, диффузионной преципитации в агаре) вирус Карши был идентифицирован как ранее неизвестный представитель рода Flavivirus. Первые работы, посвященные классификации, демонстрировали одностороннюю антигенную связь с вирусом Западного Нила. Были высказаны предположения, что вируса Карши и вируса Западного Нила являются близкими, а отличия в их антигенной активности связаны лишь с их территори

Род Flavivirus включает в себя приблизительно 80 видов, большинство из которых переносятся членистоногими. Представители этого рода наряду с вирусами родов Pestivirus и Hepacivirus объединены в семейство Flaviviridae [37,113]. Основываясь на традиционных методах вирусной классификации (наличие одноцепочечной инфекционной оболочки, РНК, изометрического оболочечных нуклеокапсида, липопротеиновой количество пептидов), флавивирусы прежде относили к семейству Togaviridae, которое включало 4

Зрелая вирусная частица имеет сферическую форму от 40 до 60 им в диаметре и состоит из электронно-плотного нуклеокапсида, окружённого липидным бислоем (рис. 1). Присутствие липидной оболочки объясняет инактивацию органическими растворителями и неионными детергентами. Оболочка защищает геном от клеточных рибонуклеаз [43]. Незрелый еирион Зрелый еирион Трипсин Нуклеокапсвд (С) Рисунок 1. Схематическое изображение структуры вириона флавивирусов [50]. Липопротеиновая оболочка вириона обра

Геном флавивирусов состоит из однонитевой РРЖ, протяжённостью примерно 11 тысяч нуклеотидных оснований (н.о.). На 5'-конце РНК содержит КЭН (т G5^ppp5'A), а поли-^ последовательность на 3'-конце отсутствует [111]. Однако, у некоторых представителей ККЭ (штамм Neudoerfl западного субтипа вируса Tick-borne encephalitis) внутри 3'концевого нетранслируемого региона находится последовательность, состоящая примерно из 50 адениновых остатков. Геномная Р1Ж представляет собой мРНК для трансляции един

Геном флавивирусов транслируется как большой полипротеин, процессинг которого происходит кои посттрансляционно при помощи клеточных протеаз и вирусной сериновой протеазы [59], в результате чего образуются 10 дискретных продуктов. Как показано на рисунке 2, Nконцевой участок полипротеина кодирует структурные белки, а далее следуют неструктурные белки в следующем порядке: C-prM-E-NSl-NS2ANS3-NS4A-NS4B-NS5 [95]. 5'-НТР ОРС З'-НТР с ргМ NS4b NS5 рг М Рис. 2. Схематическое изображе

В процессах связывания и проникновения вируса в клетку хозяина, как полагают, участвуют клеточные рецепторы (рис. 5). Слияние оболочки вириона с клеточной мембраной высвобождает нуклеокапсид в цитоплазму [69]. Позитивная геномная РНК вируса попадает в рибосомальный аппарат клетки, где и происходит синтез полипротеина-предшественника. При помощи вирусных и клеточных протеаз из полипротеина нарезаются вирусные белки, в том числе и РНК-зависимая-РНК-полимераза. Стоит 31 заметить, что вирусная и

1.6. Филогенетические взаимоотношеиия иредставителей рода Flavivirus Применение в вирусологии методов молекулярной биологии, биохимии, биофизики и математического анализа внесло существенные коррективы в разработку и усовершенствование классификации вирусов. Ранее разделение вирусов на те или иные таксономические единицы проводилось с учётом морфологии и серологических исследований, что было не всегда корректно. Сравнительная характеристика вирусных РНК-геномов, их фрагментов, вирусосп

В качестве исследуемого материала были использованы штаммы вируса Карши из коллекции вирусов ГУ НИИ вирусологии им. Д.И. Ивановского. Все они были выделены в период экспедиций 19691979 гг., когда было изолировано более 500 штаммов, среди которых 20 не были классифицированы [10]. Для определения полной нуклеотидной последовательности генома и установления систематического положения были взяты 2 штамма вируса Карши: LEIV-2247 Uz и LEIV-7192 Тиг. Штамм LEIV-2247 Uz был выделен в октябре 1972 г

В работе были использованы синтетические олигонуклеотиды производства фирмы "Литех". Структуры праймеров и их назначение приведены в таблице 2. Таблица 2 Первичная структура олигонуклеотидных праймеров, использованных в работе № 1 2 Последовательность олигонуклеотидного нраймера GGCCACGCGTCGACTAGTACGGGGGGGGGG GGCCACGCGTCGACTAGTAC Название** 5'-Race AUAP Применение ПЦР 5'копца ПЦР 5'конца Для работы со штаммом LEIV-2247Uz AGATTTTCTTGCACGTGCATGCG CAGCTTAGGAGAACAAGAGCTGGG GT

Выделение вирусной РНК проводили в полипропиленовых пробирках на 1,5 мл. К 200 мкл суспензии исследуемого образца (мозговая суспензия) добавляли 200 мкл лизирующего раствора (4 М гуанидин изотиоцианат, 0,5% саркозил, 100 мМ Р-меркаптоэтанол, 25 мМ цитрат натрия), перемешивали на вортексе. Добавляли 200 мкл насыщенного водой фенола, 100 мкл хлороформа и 40 мкл ацетата натрия (2 М, рН 4,5), интенсивно перемешивали в течение минуты и инкубировали 20 мин. при 4°С. Центрифугировали при 13000g в т

Реакцию обратной транскрипции (ОТ) для синтеза кДНК небольшой длины (размером до 1500 н.о.) проводили в

0.5 мл пробирках для ПНР, объём реакционной смеси составлял 5 мкл. В пробирку вносили 2,65 мкл РНК и денатурировали её при 70°С в течение 2 мин на водяной бане и сразу же переносили в лед. В пробирку с денатурированной РНК добавляли 2,35 мкл смеси следующего состава (приведены конечные концентрации реагентов): 50 мМ Трис-НС1, рН

8.3, 3 мМ MgCb, 75 мМ КС1, 10 мМ DTT, по

0.5

2.5. Проведение полимеразной цепной реакции Полученная кДЬЖ использовалась в полимеразной цепной реакции (ПЦР) для амплификации фрагментов генома вируса Карши. Полимеразную цепную реакцию проводили как в тонкостенных пробирках объемом 0,2 мл (QSP), так и в среднестенных объемом 0,5 мл (QSP) на амплификаторах Mastercycler gradient (Eppendorf, Германия) и Терцик (ДНК-технология, Россия). Так как в работе использовался высококонцентрированный вирусный материал ПЦР проводили в одностадийном вар

2.6. Онределение 5'-концевой последовательностн геномной РНК На рисунке 9 представлена стратегия амплификации 5'-концевого участка генома. геномная вирусная РНК T1387R синтез кДНК T1387R обработка РНК-азой присоединение dC к 3' концу ' терминальной трансферазой з-сс-ссI раунд ПЦР S'-Race I" I .

- I Gf ЗГСС--СС253R II раунд ПЦР AUAP i T253R Рисунок 9. Стратегия амплификации 5'-коицевого участка геномной РНК штамма Карши. Начальным этапом был синтез кДНК с олигонуклеотидн

Электрофорез препаратов ДНК проводили при комнатной температуре в 1 % агарозном геле (агароза фирмы Promega, США) в 1 хтрис-ацетатном буфере следующего состава: 40 мМ трис-ацетат рН

8.0; 2 мМ ЭДТА. Перед нанесением пробы на гель к ней добавляли 0,1 объем буфера для нанесения, содержащего 50 % глицерина, 0,2 % бромфенолового синего и 0,25 % ксиленцианола. Для визуализации ДНК гель прокрашивали в течение 10-20 минут в растворе бромистого этидия (5 мкг/мл в трис-ацетатном буфере трисацетат

2.8. Подготовка ДНК для секвенирования Перед реакцией секвенирования амплифицированные фрагменты Д1Ж проходили очистку из агарозного геля. Зону геля, содержащую фрагмент нужной длины, вырезали и растворяли в 1 мл раствора Nal (

6.6 М Nal, 16 мМ ИагБОз). После растворения агарозы добавляли 10 мкл glass milk (взвесь Silicon dioxide, обработанная азотной кислотой) и 10 мкл 2 М ацетата натрия (рН 4,5). Сорбцию ДЬЖ проводили в течение 30 мин. при 4°С. Следующим этапом выделения ПЦР-фрагмент

Первичную нуклеотидную последовательность определяли по методу Сэнгера при помош;и BigDye прямого Termination секвенирования Cycle ПЦР-продукта Kit с использованием инструкции Sequencing ДНК согласно на а в изготовителя. секвенаторе Электрофорез ABI осуществлялся DNA sequencer автоматическом Prism® 3100 последствии на ABI Prism® 3130 genetic Analyzer (Applied Biosystem, США).

2.10. Построение алайментов и филогенетический аиализ Для построения алайментов использовали алгоритмы Clustal V и Clustal W из пакета программ DNASTAR V.

3.12, производства «Lasergen Inc.» (Madison, WI). Построение филогенетических деревьев осуществляли на основе двух алгоритмов: "ближайшего соседа" или "UPGMA" в рамках 2параметрической модели М. Кимуры с последующим 5000-кратным ресэмплингом (MEGA

3.1). Для проведения исследуемых филогенетического анализа и

Получение рекомбинантных плазмид. Лигирование фрагментов ДНК, полученных в результате амплификации, проводили с вектором pGEM-T (Promega, США) в объеме Юмкл при +4 град в течение 16 часов. Для реакции лигирования использовали 5 мкл 2хбуффера (60 мМ Tris-HCl рН 7,8; 20 мМ MgCb; 20 мМ дитиотрейтола; 2 мМ АТФ и 10 % полиэтиленгликоля-6000), 0,5 мкл pGEM-T и добавляли 4,5 мкл ПЦР-продукта. Реакцию проводили с 0,5 единиц лигазы фага Т4 (Promega, США). Приготовление компетентных клеток Использо

Для определения нуклеотидной последовательности генома вируса Карши был взят штамм LEIV-2247 Uz. При амплификации первого фрагмента кДНК были использованы вырожденные олигонуклеотидные праймеры (ОП), подобранные на участок гена Е вируса Западного Нила: WN1048F и WN1856R. Учитывая, что вирус Карши в качестве генома имеет (+) РНК, реакцию ОТ проводили с праймером WN1856R, комплементарным геномной РНК. Оказалось, что полученный в результате ПЦР фрагмент ДНК образован лишь одним ОП WN1856R. Поэто

3.2. Определение первичной нуклеотидной носледовательности генома штамма LEIV-7192 Тиг По ранее проведённым экологии иммунологическим ГУ исследованиям в лаборатории вирусов НИИ вирусологии им. Д.И. Ивановского предполагалось, что штамм LEIV-7192 Тиг является разновидностью вируса Карши. Поэтому на первом этапе работы по амплификации кДНК были использованы ОП, подобранные в результате анализа первичной нуклеотидной последовательности 2247 Uz. Географическая удалённость штаммов штамма

3.3. Анализ структуры полноразмерного генома внруса Карши Определённая в ходе работы нуклеотидная последовательность штамма LEIV-2247 Uz составляет 10653 н.о. и 10768 и.о. для изолята^£7К7192 Тиг (за исключением участка 3'-концевого нетранслируемого региона). Нуклеотидная последовательность генома вируса Карши 2-х штаммов LEIV-2247 Uz и LEIV-7192 Tur была депонирована в базу данных GenBank под номерами и AY863002 (NC_006947) полученных и DQ462443 соответственно. Анализ сопоставление нуклеотид

Капсидный белок вируса Карши содержит 1 инициирующий кодон, аналогично началу белка С почти всех вирусов комплекса клеш;евого 71 энцефалита кроме вируса Powassan, который содержит 2 следующих друг за другом Met. Анализ аминокислотной последовательности белка С вируса Карши показал, что он содержит регионы, похожие на сайты ядерной локализации (рис.13). С обоих концов аминокислотного участка 76-96 а.о. белка С содержатся кластеры, состоящие из основных аминокислот, в свою очередь, разделяющие

3.4. Филогенетические взаимоотиошения вируса Карши и других представителей рода Flavivirus Большинство исследователей рассматривают филогенетические взаимоотношения вирусов внутри рода Flavivirus по двум наиболее консервативным белкам NS3 (протеаза / хеликаза) и NS5 (РНК-зависимая РНК-полимераза). Поэтому для проведения аналогичного установлению анализа по филогенетических связей вируса Карши с различными представителями рода Flavivirus были взяты 82 штамма, для которых известна перв

Одной из задач данной работы было создание детекционной ОТ-ПЦР тест-системы РНК вируса Карши. Для её создания необходимо было выбрать адекватные участки генома для дизайна олигонуклеотидных праймеров. С этой целью нами было проведено сравнение полноразмерных нуклеотидных последовательностей генома вирусов ККЭ, опубликованных в базе данных GenBank, с использованием пакета компьютерных программ DNASTAR. Учитывая вариабельность генов вируса, при его обнаружении необходимо использовать олигонукл