Низкая цена
Всего 249a за скачивание одной диссертации
Скидки
75 диссертаций за 4900a по акции. Подробнее
О проекте

Электронная библиотека диссертаций — нашли диссертацию, посмотрели оглавление или любые страницы за 3 рубля за страницу, пополнили баланс и скачали диссертацию.

Я впервые на сайте

Отзывы о нас

Изотермические и управляемые сменой температур реакции амплификации и высокочувствительной детекции специфичных последовательностей нуклеиновых кислот в реальном времени : диссертация ... кандидата биологических наук : 03.00.03

Год: 2006

Номер работы: 71630

Автор:

Стоимость работы: 249 e

Без учета скидки. Вы получаете файл формата pdf

Оглавление и несколько страниц
Бесплатно

Вы получаете первые страницы диссертации в формате txt

Читать онлайн
постранично
Платно

Просмотр 1 страницы = 3 руб



Оглавление диссертации:

1) FRET - fluorescence (Forster) resonance energy transfer, перенос флуоресцентной (Фёрстера) резонансной энергии Растворы: ТЕ - трис-ЭДТА буфер ТАЕ - трис-ацетатный буфер ТВЕ - трис-боратный буфер Биохимикаты: НАД - никотинамидадениндинуклеотид ТЕМЕД - тетраэтилметилендиамин БСА - бычий сывороточный альбумин ДДС - додецилсульфат натрия ДТТ - дитиотрейтол НЭГ - нолиэтиленгликоль Трис - трис(гидроксиэтил)аминометан ЭДТА - этилендиаминтетрауксусная кислота Реакции амплификации и высокочувств

Актуальность темы. После своего появления в середине 80-х гг. полимеразная цепная реакция (ПЦР) [Saiki et al., 1985; 1988] очень быстро стала но существу методом №1 в фундаментальных исследованиях нуклеиновых кислот и в ДНК-диагностике. Оставаясь таковым и ноныне, она все же сильно изменилась, что в первую очередь связано с нереводом этой реакции в режим реального времени, где детекция накопления ампликонов ведется в ходе самого процесса амплификации. НЦР в реальном времени (ПЦР-РВ) во мн

1.2. Полимеразная цепная реакция в реальном времени - ПЦР-РВ Из воспоминаний R.Higuchi [Gingeras et al, 2005] следует, что в конце 80-х годов перед ним и его коллегами руководством компании Cetus была поставлена задача преобразовать полимеразную цепную реакцию так, чтобы продукты амплификации можно было контролировать прямо в ходе самой реакции, не прибегая к помощи гель-электрофореза. Однако ими в течение ряда лет разрабатывался совершенно бесперспективный вариант такой детекции, основанный

Лигазная цепная реакция гораздо менее известна и русскоязычных обзоров по ней просто нет, если не считать одну работу, в которой, наряду с ПЦР, очень кратко упоминается ЛЦР [Белохвостов, 1995]. Впрочем, надо заметить, что и в мировой литературе имеются весьма немногочисленные обзорные статьи, посвященные ЛЦР и те, главным образом, датированы началом и серединой 90-х гг. [Birkenmeyer, Mushahwar, 1991; Landegren, 1993; Wiedmann et al, 1994; Wirm-Deen, 1996], причем название одной из работ [Bara

A) Благодаря тому, что некоторые ДНК полимеразы обладают особой активностью, смещающей старую цень ДНК при построении новой, был разработан оригинальный метод ДНК амплификации, протекающей в изотермических условиях [Walker et al., 1992; 1992а]. Если в реакциях, управляемых сменой температур, этап денатурации необходим для появления в реакционной смеси новых одноцепочечных матриц ДНК, то в этом случае сама ДНК полимераза (в ранних экспериментах - Кленовский фрагмент ДНК полимеразы I Е.соЩ вы

1.5. Амплификация no типу катящегося кольца или рамификация Другим вариантом амплификации ДНК смещением цепи является амплификация по типу катящегося кольца (Rolling Circle Amplification RCA), также протекающая в изотермических условиях. Впервые RCA была применена для анализа однонуклеотидных замен в 1998 г. [Lizardi et al., 1998]. Нринцип метода заключается в образовании кольцевой одноцепочечной молекулы ДНОК из линейного олигонуклеотида длиной, как правило, свыше 80 оснований путем лигиров

Предложенная в самом начале 90-х гг. прошлого столетия [Duck et al., 1990] технология циклирующей пробы (ТЦП), основанная на уникальном свойстве РНКазы П разрушать гетеродуплексы РНК/ДПК, не затрагивая при этом ни одноценочечные нуклеиновые кислоты, ни двуцепочечные структуры РПК/РПК или ДНК/ДПК, к сожалению, пока не получила должного развития. И это тем более удивительно, поскольку ТЦП позволяет заметно повышать чувствительность экспериментов по молекулярной гибридизации нуклеиновых кислот

Собственно гибридизация комплементарных цепей ДЬЖ или РНК лежит в основе всех методов амплификации и высокочувствительной детекции этих биополимеров. Однако гибридизационный сигнал ранее исходил от единичного события образования двуцепочечных структур нуклеиновых кислот в локальном участке. И даже в случае применения циклируюш;ей пробы количество мест гибридизации оставалось неизменным. Также одно место отжига характерно для отдельного класса используемых для усиления гибридизационного сигн

При выполнении данной работы объектами исследований служили как искусственные молекулы ДНК (олигонуклеотиды) химическим нутем и РЬЖ методом были (рибоолигонуклеотиды), фосфорамидитного синтезированные (табл. синтеза

2.1.). Олигонуклеотиды синтезирована в ИБГ УНЦ РАН, в ЗАО "Синтол" (Москва) и ННО "Литех" (Москва). В работе также были иснользованы природные молекулы ДНК и РЬЖ, имеющие вирусное происхождение (вирус птичьего гриппа субтипа H5N1, хантавирус сероти

2.2. Фосфорилнрование олигонуклеотидов Те олигонуклеотиды, использовать которые не планировалось иначе как для лигирования, сразу подвергались химическому фосфорилировапию еще в процессе синтеза во время этапа введения фосфатной грунны с помощью специального фосфорамидита Chemical Phosphorylation Reagent П. Для олигонуклеотидов, использование которых предполагалось и без фосфатной группы на 5'-конце, применялось 50 ферментативное фосфорилирование, которое проводили в мкл реакционной смеси,

Учитывая используемых сверхвысокую в данной детекции чувствительность работе реакций НИР и остальных и амплификации особая высокочувствительной нуклеиновых кислот, забота, нанравленная на исключение возможного нерекрестного загрязнения образцов ДНК и РНК, была проявлена при их выделении из разных образцов и объектов. С этой целью экстракция ДНК или РНК, включая стадию гомогенизации, велась в одноразовых полипропиленовых микроцентрифужных пробирках. ДНК из разных методом биологическ

2.4. Но лучение кДЬЖ Для амплификации методов РНК-содержащего этап материала по с помощью большинства необходим построения матрице РНК комплементарной ДНК с помощью фермента обратной транскриптазы. Нредварительно в микроцентрифужной пробирке смешивали 0,2 мкг РНК и 2 3 пмоль олигонуклеотида, служащего в качестве праймера. Реакцию обратной транскрипции вели при 42°С в течение 10 мин в реакционном объеме 20 мкл следующего состава - 50 мМ Трис-НС1 рН

8.3, 10 мМ MgCb, 10 мМ ДТТ,

НДР "по конечной точке" проводили в 30 мкл реакционной смеси, содержащей буфер (40 мМ Трис-НС1 рН

8.0,

2.5 мМ MgCb, 25 мМ КС1), 20 фмоль ДНК, 1 ед. акт. Taq ДНК полимеразы, по 5 пмоль каждого из 2-х праймеров и но 0,25 мМ каждого из дНТФ. НЦР проводили в ДНК амплификаторе модели Терцик (ДНК-Технология, Россия) при следующих условиях: денатурация двуценочечной Д1Ж в нервом цикле велась при 94°С в течение 2 мин, затем следовал отжиг праймеров и их удлинение при температура

2.6. Полимеразная цепная реакция в реальном времени НЦР в реальном времени на платформе "УФА" проводили в 25 мкл реакционной смеси содержащей: буфер (40 мМ Трис-НС1 рН

8.0,

2.5 мМ MgCl2, 25 мМ КС1); 20 фмоль ДНК; 1 ед. акт. Taq ДНК полимеразы; по

0.5 пмоль прямого и обратного праймеров, меченных разными флуорохромами (донором и акцептором), по 0,25 мМ калодого из дНТФ и соответствующее количество дистиллированной воды. НЦР-РВ проводили в Д1Ж амплификаторах моделей

2.7. Лигазная цепная реакция в реальном времени с красителем SYBR Green I ЛЦР-РВ проводили в 25 мкл реакционной смеси содержащей: буфер (40 мМ Трис-НС1 рН

8.0, 5 мМ MgCb, 25 мМ КС1,2 мМ спермидина, 5 мМ ДТТ,

0.1 мМ НАД); 20 фмоль ДНК; 10 ед.акт. Tth или Taq ДНК лигазы; по 5 пмоль каждого из 4-х олигонуклеотидов, два из которых (2 и

4) были фосфорилированы, и соответствующее количество дистиллированной воды. ЛЦР-РВ проводили в ДНК амплификаторе модели iCycler iQ при следующи

2.8. Лигазная ценная реакция, основанная на FRET-эффекте, в режиме реального времени ЛЦР-РВ, основанную на FRET-эффекте, проводили аналогичным образом, как и ЛЦР с красителем SYBR Green I, за исключением того, что отсутствовал этап денатурации одиночных дуплексов, и регистрация свечения велась в конце стадии денатурации двойного дуплекса. Другим отличием было то, что олигонуклеотиды 1 и 2 (или 3 и

4) несли соответствующие флуоресцентные красители (донор и акцептор).

Для проведения амплификации по механизму катящегося кольца необходимо предварительное получение кольцевой олигонуклеотидной одноцепочечной матрицы. Нревращенне в "0-кольцо" линейной "С-пробы" осуществляли путем лигирования копцов последней на синтетическом олигонуклеотиде, имитирующем природную последовательность ДНК вируса птичьего гриппа. Для этого фосфорилированный олигонуклеотид HNZYM96, несущий в своем составе антисенс-последовательность дезоксирибозима 10-23, отжи

Для проведения рамификации также необходимо получение кольцевой одноцепочечной матрицы. Превращение в "0-кольцо" линейной "С-пробы" осуществляли аналогично путем лигирования концов последней wHhmgtn, (олигонуклеотида HQSF84) на синтетическом олигонуклеотиде имитирующем нриродную последовательность ДНК вируса птичьего гриппа. Для этого фосфорилированный олигонуклеотид HN84, несущий в своем составе места для отлсига праймера 1 и копию праймера 2, отжигали с олигонуклеотидо

2.11. Гибридизационная ценная реакция в реальном времени ГЦР-РВ проводили изотермически в 30 мкл раствора lxSSC (

0.015 М цитрата натрия +

0.15 М хлористого натрия) при температурах от 25° до 45°С в ДНК амплификаторе собой lxSSC. модели и к iCycler вторую ним iQ. Олигонуклеотиды, предварительно соответствующая представляющие смешивались в первую Затем шпильки, добавлялась инициаторная молекула ДНК или РНК, запускающая процесс самосборки, или прочие нуклеиновые кислоты, влияни

Электрофоретический анализ ампликонов и исходных молекул нуклеиновых кислот Электрофоретический анализ (контроль) продуктов ПЦР-РВ, ЛЦР-РВ, ГЦР-РВ, а также рамификации проводили в 10 - 12%-ных полиакриламидных гелях в ТАЕ буфере рН

7.8 в неденатурирующих условиях при градиенте напряжения 10V на см длины геля в приборе вертикального типа MiniPROTEAN 3 (Bio-Rad, США) с размером пластин 9 х 10 см при толщине геля 1 мм в течение 2 - 4 часов. Анализ более крупных молекул РНК или ДНК, включая

2.13. Компьютерный анализ нуклеотидных последовательностей Компьютерный анализ нуклеотидных последовательностей, подбор праймеров и олигонуклеотидов проводили с помощью пакета компьютерных программ Lasergene фирмы DNASTAR Inc. (США) и Oligo

4.1 (National Biosciences Inc., США).

Таблица

2.1.1. обозначение hglnF hglnR wHhmgtn 35S-1(F)PCR 35-2(R)PCR HVl-long HV311ong HV31-Xlong HV31FD gusintlong gusintshort gusintFAM gusintROX N-SRSl-FAM N-SRS3-ROX 35S-1-LCR 35S-2-LCR 35S-3-LCR 35S-4-LCR 35S-3-LCR(FAM) нуклеотидная последовательность, 5'>3' TGGAATATGGTAACT(FAM)GCAAC* ATTGGAGTTTGACACT(ROX)TGG TGGAATATGGTAACTGCAACACCAAGTGTCAAACTCCAAT GCTCCTACAAATGCCATCA GATAGTGGGATTGTGCGTCA AAGCCTTAGGTATGGAAATGTC TAT T TAAT GT CAAT GGCATT TACAT CAAG CATAATATTTAATGTCAATGGCATTTACA

Ферменты: ДНК-лигаза фага Т4 (Fermentas, Литва) Рестрикционная эндонуклеаза Mspl (Feraientas, Литва) Рестрикционная эндонуклеаза Pstl (Feraientas, Литва) Рестрикционная эндонуклеаза Trul (Feraientas, Литва) Taq полимераза (Feraientas, Литва, Сибэнзим, Россия, Силекс, Россия) Taq лигаза (New England Biolabs, США) Tth лигаза (Синтол, Россия) Красители: Бромфеноловый синий (C.A.F. Kahlbaum Chem. Fabrik., Германия) ксиленцианол (Serva, Германия) Этидиум бромид (Fluka, Швейцария) SYBR Green I (Mol

1X SSC 1X ТАЕ 1х ТВЕ

0.15 М NaCl,

0.015 М цитрат натрия 40 мМ Трис-ацетат (рН

7.6), 2 мМ ЭДТА 90 мМ Трис-основание, 9 мМ борной кислоты, 2 мМ ЭДТА 1X ТЕ 10 мМ Трис (рН

8.0), 1 мМ ЭДТА 3. РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

3.1, Полимеразная цепная реакция в реальном времени Несмотря на огромное количество всевозможных вариантов ПЦР-РВ, рассмотренных нами в соответствующем разделе литературного обзора, все они принципиально отличаются от разработанного нами как расположением праймеров, так и их мечением. Считается, что в ПЦР праймеры должны отстоять друг от друга на некотором расстоянии и, пожалуй, главной причиной этого служит некий стереотип мышления. Действительно, одно из главных предназначений ПЦР - это дав

Получив некоторое развитие в первой половине 90-х гг. прошлого столетия, ЛЦР затем оказалась почти забытой. Причины такого забвения ЛЦР отчасти обусловлены переводом ее мощного конкурента - ПНР в режим реального времени и последовавшим за этим интенсивным развитием этой реакции. Определенная трудность в детекции целевых продуктов и имеюш,ее место явление нематричного лигировапия, повышаюп];его частоту ложнопозитивных результатов, также не способствовало востребованности ЛЦР. Тем не менее, пре

дезоксирибозимным расщеплением химерной пробы Как было ранее показано в нашей лаборатории [Гарафутдинов, 2006] объединение технологий циклирующей пробы и молекулярного сигнального огня, совмещенные с амплификацией по типу катящегося кольца, позволяет успешно детектировать однонуклеотидный полиморфизм. При этом для осуществления данной реакции необходимо участие трех ферментов - ДНК лигазы, матрицы обеспечивающей на дискриминирующее фрагменте ДНК; лигирование ДНК кольцевой со анализируемом п

Поскольку объединение технологии амплификации ДНК по типу катящегося кольца с регистрацией этого процесса с помощью циклирующеи пробы, расщепляемой под действием образующегося при смещении старой цепи ДНК дезоксирибозима 10-23, не в состоянии обеспечить полноценную экспоненциальную представляет амплификацию, то рамификации, значительно где наличие больший двух интерес реакция праймеров, обеспечивает экспоненциальное накопление разветвленных продуктов такой реакции. С этой целью была синтез

Движущей силой ГЦР является временно сокрытая энергия, заключенная в олигонуклеотидных наноструктурах, представляющих собой шпильки с верхушечной участком. петлей, В наших двуцепочечным экспериментах стержнем их и одноцепочечным размеры соотносились как 1:3:1 и в большинстве случаев были равны для петли шести звеньям, для двуцепочечного стержня - восемнадцати парам иуклеотидов и для выступающего одноцепочечного участка - также шести звеньям. Линейная запись может данных быть разноразмерн